Invitation To Bid ( ITB, Tender Notice)

Package 269: Probe for realtime PCR

    Watching    
Find: 14:43 30/09/2020
Notice Status
Posted for the first time
Notify Area
Goods
Name of project
Regular procurement and repair in 2020 from the non-business revenue of the Region 4 Agro-Forestry-Fisheries Quality Center
Name of Tender Notice
Package 269: Probe for realtime PCR
Contractor Selection Plan ID
Name of Contractor selection plan
Regular procurement and repair in 2020 from the non-business revenue of the Region 4 Agro-Forestry-Fisheries Quality Center
Spending Category
Mandatory spending activities
Funding source
Revenues earned from non-productive activities
Range
Within the scope of the Law on Bidding
Method
Single Stage Single Envelope
Contract Type
All in one
Contract Period
To view full information, please Login or Register
Contractor selection methods
National shortened competitive bidding
Package execution location
Time of bid closing
11:00 07/10/2020
AI-classified business sector

Participating in tenders

Bidding method
Online bidding
Tender documents submission start from
14:36 30/09/2020
to
11:00 07/10/2020
Document Submission Fees
Tender Document Submission at
To view full information, please Login or Register

Bid award

Award date
11:00 07/10/2020
Awarded at
Website: http://muasamcong.mpi.gov.vn
Price Tender value
To view full information, please Login or Register
Amount in text format
To view full information, please Login or Register
Bid Opening Result
See details here . If you want to receive automatic bid opening notification via email, please upgrade your VIP1 account .
Bid award
See details here . If you want to receive automatic contractor selection results via email, please upgrade your VIP1 account .

Bidding documents

Bidding documents on the Public Procurement System may be infected with viruses or errors, some files require computers using Windows operating systems and need to install Client Agent software (Linux and MacOS operating systems cannot install Client software) to be able to download. Using DauThau.info software, you can check all the above problems as well as preview the total size of the bidding documents to prevent missing files from downloading.
Downloading files directly on the new Public Procurement System requires a computer using Windows operating system and installing Client Agent software (Linux and MacOS operating systems cannot install Client software yet). Therefore, to be able to download files on smartphones, tablets or computers using operating systems other than Windows, you need to use DauThau.info software to download files.
To download, please Login or Register

List of goods:

Number Category Goods code Amount Calculation Unit Description Note
1 Probe cho realtime PCR
11 ống - Probe được tổng hợp dưới dạng đông khô - Nồng độ oligo của probe (amount of oligo) ≥ 30 nmoles/ ống - Trình tự các ống probe như sau (mỗi trình tự 1 ống): + pat_Probe: 5’-FAM-CTTCCAGGGCCCAGCGTAAGCA-TAMRA-3’ + cry1Ab/Ac_Probe: 5'-FAM-ACATGAACAGCGCCTTGACCACAGC-NFQ-3 + Rice_GOS9_Probe: 5'-FAM-CGGCAGTGTGGTTGGTTTCTTCGG-Dabcyl-3' + bar_Probe: 5'-FAM-TACCGAGCCGCAGGAACC-TAMRA-3 + YK1-Probe: 5’-FAM- AGACGCCATGGAAGG-MGB-3’ + YK2-Probe: 5’-FAM- TCC CTT CCA TGG CGT C- TAMRA-3 + Papaya_Q-Chy-P: 5’-FAM-TTC CCT TCA T(BHQ1)CC ATT CCC ACT CTT GAG A-3’ + Noro GI_probe2: 5'- FAM - TGG ACA GGA GAT CGC – MGB - 3' + VNN_Probe: 5' - FAM - TYC-ARG-CRA-CTC-GTG-GTG-CVG - BHQ - 3' + Shigella-EIEC_Probe: 5' -FAM- CCTCCGCACTGCCGAAGCCA -BHQ- 3' + pUC19_Probe: 5' - Cy5 - TAAGGAGAAAATACCGCATCAGGCGCC - BHQ - 3' Ghi chú: đuôi BHQ có thể thay thế bằng BHQ1 hoặc BHQ2 và ngược lại

Bidding party analysis

Data analysis results of DauThau.info software for bid solicitors Trung tâm Chất lượng, Chế biến và Phát triển thị trường vùng 4 as follows:

  • Has relationships with 250 contractor.
  • The average number of contractors participating in each bidding package is: 2.40 contractors.
  • Proportion of bidding fields: Goods 90.34%, Construction 0.45%, Consulting 0.45%, Non-consulting 6.96%, Mixed 0.00%, Other 1.8%.
  • The total value according to the bidding package with valid IMP is: 285,311,491,689 VND, in which the total winning value is: 248,087,156,329 VND.
  • The savings rate is: 13.05%.
DauThau.info software reads from national bidding database

Utilities for you

Bidding information tracking
The Bid Tracking function helps you to quickly and promptly receive email notifications of changes to your bid package "Package 269: Probe for realtime PCR". In addition, you will also receive notification of bidding results and contractor selection results when the results are posted to the system.
Receive similar invitation to bid by email
To be one of the first to be emailed to tender notices of similar packages: "Package 269: Probe for realtime PCR" as soon as they are posted, sign up for DauThau.info's VIP 1 package .

Bidding cost calculator

Costs related to contractors when conducting bidding on public procurement (Article 12 of Decree 24/2024/ND-CP)

Cost type Calculation formula Applicable fees (VND)
Annual account maintenance cost
Bid submission cost
Bid submission cost
Bid winning cost
Electronic bid bond connection cost
Total estimated cost

To view bid costs

You need to Login or Register to view the bidding cost.
Support and Error reporting
Support
What support do you need?
Reporting
Is there an error in the data on the page? You will be rewarded if you discover that the bidding package and KHLCNT have not met the online bidding regulations but DauThau.info does not warn or warns incorrectly.
Views: 169

You did not use the site, Click here to remain logged. Timeout: 60 second