Contact Us
- 0904.634.288, 024.8888.4288
- [email protected]
- Facebook Fanpage: http://fb.com/dauthau.info
- Messenger: http://m.me/dauthau.info
Contact Us
-- You will be rewarded if you detect false warnings! See instructions here!
Bidding documents on the Public Procurement System may be infected with viruses or errors, some files require computers using Windows operating systems and need to install Client Agent software (Linux and MacOS operating systems cannot install Client software) to be able to download. Using DauThau.info software, you can check all the above problems as well as preview the total size of the bidding documents to prevent missing files from downloading.
Downloading files directly on the new Public Procurement System requires a computer using Windows operating system and installing Client Agent software (Linux and MacOS operating systems cannot install Client software yet). Therefore, to be able to download files on smartphones, tablets or computers using operating systems other than Windows, you need to use DauThau.info software to download files.
To download, please Login or Register
| Number | Category | Goods code | Amount | Calculation Unit | Description | Note |
|---|---|---|---|---|---|---|
| 1 | Probe cho realtime PCR | 11 | ống | - Probe được tổng hợp dưới dạng đông khô - Nồng độ oligo của probe (amount of oligo) ≥ 30 nmoles/ ống - Trình tự các ống probe như sau (mỗi trình tự 1 ống): + pat_Probe: 5’-FAM-CTTCCAGGGCCCAGCGTAAGCA-TAMRA-3’ + cry1Ab/Ac_Probe: 5'-FAM-ACATGAACAGCGCCTTGACCACAGC-NFQ-3 + Rice_GOS9_Probe: 5'-FAM-CGGCAGTGTGGTTGGTTTCTTCGG-Dabcyl-3' + bar_Probe: 5'-FAM-TACCGAGCCGCAGGAACC-TAMRA-3 + YK1-Probe: 5’-FAM- AGACGCCATGGAAGG-MGB-3’ + YK2-Probe: 5’-FAM- TCC CTT CCA TGG CGT C- TAMRA-3 + Papaya_Q-Chy-P: 5’-FAM-TTC CCT TCA T(BHQ1)CC ATT CCC ACT CTT GAG A-3’ + Noro GI_probe2: 5'- FAM - TGG ACA GGA GAT CGC – MGB - 3' + VNN_Probe: 5' - FAM - TYC-ARG-CRA-CTC-GTG-GTG-CVG - BHQ - 3' + Shigella-EIEC_Probe: 5' -FAM- CCTCCGCACTGCCGAAGCCA -BHQ- 3' + pUC19_Probe: 5' - Cy5 - TAAGGAGAAAATACCGCATCAGGCGCC - BHQ - 3' Ghi chú: đuôi BHQ có thể thay thế bằng BHQ1 hoặc BHQ2 và ngược lại |
Data analysis results of DauThau.info software for bid solicitors Trung tâm Chất lượng, Chế biến và Phát triển thị trường vùng 4 as follows:
- Has relationships with 250 contractor.
- The average number of contractors participating in each bidding package is: 2.40 contractors.
- Proportion of bidding fields: Goods 90.34%, Construction 0.45%, Consulting 0.45%, Non-consulting 6.96%, Mixed 0.00%, Other 1.8%.
- The total value according to the bidding package with valid IMP is: 285,311,491,689 VND, in which the total winning value is: 248,087,156,329 VND.
- The savings rate is: 13.05%.
Costs related to contractors when conducting bidding on public procurement (Article 12 of Decree 24/2024/ND-CP)
If you are still not our member, please sign up.You can use your account on DauThau.info to log in to Dauthau.Net, and vice versa!
Only 5 minutes and absolutely free! Your account can be use on all over our ecosystem, including DauThau.info and DauThau.Net.
Detailed instructions on how to deposit money and redeem points on DauThau.info
When does contract negotiation fail?
[VIDEO] Guide for bid solicitors to Extend the Bid Submission Deadline
[VIDEO] Guide to Evaluating Bid Documents on the New National Bidding Network System
[VIDEO] Guide to Posting Tender Notices for PPP Projects
[VIDEO] Guide to Posting Prequalification Notices for PPP Projects
[VIDEO] Guide to Responding to Clarification Requests for e-HSMST (E-Prequalification Invitation Documents) of PPP Projects on the New National Bidding Network System
[VIDEO] Guide to Uploading the Shortlist for PPP Projects
Are you sure you want to download the cargo data?
No goods data
Are you sure you want to download the construction equipment data? If yes, please wait a moment while the system processes your request and downloads the data to your device.
Similar goods purchased by Investor Trung tâm Chất lượng, Chế biến và Phát triển thị trường vùng 4:
No similar goods purchased by the Investor were found.
Similar goods purchased by other Investor excluding Trung tâm Chất lượng, Chế biến và Phát triển thị trường vùng 4:
No similar goods have been found that other Investor have purchased.
Similar goods for which the bidding results of the Ministry of Health have been announced:
No similar goods have been found in the bidding results of the Ministry of Health.